Specimen/occurence ID

P_tokiensis_Tochigi_Nasu_5 (@GEDIMAP)

GEDIMAP-P5 (@GEDIMAP)

Species
NFrequency

10

Comment(s)

primor information: L15923:5'ttaaagcatcggtcttgtaa H16500:5'gccctgaaataggaaccaga

Property

Native or Alien: Native

Specimen/observation type: Secondary/literature information

DNA information
.fasta
.arp [Arlequin]

C (CR) [7]

D (CR) [2]

E (CR) [1]

Locality/Year/Month

st_3_Naka_Naka

Nasu-town 那須町 Naka-gawa Tochigi Prefecture Japan

1998/11

Associated source

Watanabe, K. and M. Nishida (2003) Genetic population structure of Japanese bagrid catfishes. Ichthyol. Res., 50: 301-309

Circle center does not necessarily imply the sampling point

Map Wheel Zoom