Specimen/occurence ID

G_aculeatus_complex_Hokkaidou_Nanae_JA9 (@GEDIMAP)

GEDIMAP-P412 (@GEDIMAP)

Species
NFrequency

1

Comment(s)

primor information: L14724:5'cgaagcttgatatgaaaaaccatcgttg; H15525:5'tttgcaggggtaaaattatcaggat

Property

Native or Alien: Native

Specimen/observation type: Secondary/literature information

DNA information
.fasta
.arp [Arlequin]

H (cyt-b) [1]

Locality/Year/Month

st_JA9_Nanae

Nanae 七飯町 O-numa Pond Hokkaido Prefecture Japan
Associated source

Orti, G., M. A. Bell, T. E. Reimchen and A. Meyer (1994) Global survey of mitochondrial DNA sequences in the threespine stickleback: evidence for recent migration. Evolution, 48(3): 608-622.

Circle center does not necessarily imply the sampling point

Map Wheel Zoom