Specimen/occurence ID

P_ichikawai_Gifu_14 (@GEDIMAP)

GEDIMAP-P14 (@GEDIMAP)

Species
NFrequency

11

Comment(s)

primor information: L15923:5'ttaaagcatcggtcttgtaa H16500:5'gccctgaaataggaaccaga

Property

Native or Alien: Native

Specimen/observation type: Secondary/literature information

DNA information
.fasta
.arp [Arlequin]

G (CR) [11]

Locality/Year/Month

st_11_Kiso_Maze

Kiso-gawa Gifu Prefecture Japan
Associated source

Watanabe, K. and M. Nishida (2003) Genetic population structure of Japanese bagrid catfishes. Ichthyol. Res., 50: 301-309

Circle center does not necessarily imply the sampling point

Map Wheel Zoom